Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267205
Length 433 bp
Fasta Format > whoh10f02
ggttgctggatcttcttgcaggggaggaaaaaggccggcgatggacggcg ggaagaagagccgggacccgtacaagctgccgcaggagcgcagggaccgc aagtcaggctccgggatgagcggcgacgccaagaagggcggccgtggcgg caagttcacctgggagggcgccgacggctacaccgacgaggatcttgacc tcatcggcaacaagggcagggggaccggcgcctccgacaacaagaagtcc tagggagatggcgacccctccgacgagtaggcgctacgtcatccggccct gcccgcccgtcttcttcctgtccgatcgatcccaagcctgcacggtgtca actttcgttagctttctcgtgtctgttattaaataatacgatcgaatcgt ggcctctttggcaatgtacgtactatatgatct
Download
page-top