Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267204
Length 515 bp
Fasta Format > whoh10e23
gcacgaggcgtgaaccgcgtggtgtcgtccatgttcaacacggtgtccgg caagaagatcgccgtgctcgggttcgccttcaagaaggacacgggcgaca cccgggagacgccggcgatcgacgtgtgcaagggcctggtgggcgacaag gcccaggtgagcatctacgacccgcaggtgacggaggatcagatccagcg ggacctggccatgaacaagttcgactgggaccacccgatgcacctgcagc cgaccagccccacggcggtgaagcaggtgagcgtggtgtgggacgcgtac gaggccgccaagggcgcccacggcgtgtgcatcctcaccgagtgggacga gttcaagaagctcgactaccagaagatcttcgacaacatgcagaagcccg ccttcgtgtttgacggccgcaacgtcgtcgacgccgagaagctcagggag atcggcttcatcgtctactccatcggcaagccgctcgacggctggctcaa ggacatgcccgccgt
Download
page-top