Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267203
Length 509 bp
Fasta Format > whoh10e22
ttcggcacgagggcttttatggtggcaagaggtgatttggggatggaaat tcctgtagagaagatcttttatgcacagaaggtgatgattttcaagtgca acattcagggcaagccagttgtgaccgcaactcagatgttggagtctatg atcaagtctcctcgccctactcgagctgaagcaaccgatgttgccaatgc agttcttgatggcactgactgtgtcatgctcagtggtgagacagctgctg gagcttatccagaactggcagtgcaaactatggccaagatctgcttgcag gccgagtcatgtgtggactattctgctgtttttaagtcaatcatgtcatc agccccaattcccatgagcccattggagagccttgcctcatcagctgtcc gcacagcgaactcagccaaggcgacgcttatcttggtactgaccanggga ggaacaacctgcaaggcttgtagccaagtataggccatccatgccgatac tgtctgtcg
Download
page-top