Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267199
Length 456 bp
Fasta Format > whoh10e13
gcgaaattttctcgcgagnagttcgtgtgtagtagaggagttgaggagat gaagccggcggttgaaggtgacgagcgtgcggcggagatcgcccgcatca aggctgccgcggccgccgccaaaaaggcggcggaagaggtggtggatgtg gacgatgagggtgaggacgacgagggagatgaggaggaggaggcggttga cggcgacgacgacgacgacgacgacgaagtcgacgacgatggggaagagg acgaggacgagggggtggagggtgaggataaggggtcggcggcgcagcag gtggtcgacatctccgacgaggacgacgacggcggtgatgaagaggaggg cggtgacgaatgatgacgacgacgacgacgacgacgatgacgaggaggat gacgacgaagtcgacgaggaggaagagcccgaggaggagctaggaactga atatct
Download
page-top