Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267192
Length 568 bp
Fasta Format > whoh10e01
ttcggcacgaggctctgttcctcttcctctctcgctcgctactctgtctt cctcctcaaatcttcctctgcacttgatccaaactcaaattccagagaga tatccagtggtagctagaggtcagggagggagagggacaatggcgcgagc ctttcttgcctccgccgctgcagcgggcttcggggcgcaggcgcagcaga ctccgtggctccttctactgctggtggtgctggtcatatcggtcttcctc tgcggcgacacctccaagaagaagaaggccagtgcaaagcgggcggcggc gaccactgcaagttcgtcgaccaaatcagccggcggtaataccttcctct ttcttgctgcgggcggaggcggagggggcggtggcggagggtgcggtggc ggttgcggtgcctagctagaggagctgcagcctgcagcgcaggaaggcat ggcttgagccggaacccggagctgctacgggactctctatagtatggatc cctccctgcagttactacttagtagtcgatcactagatttgggttcgatg atgtattgcaagaaacat
Download
page-top