Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267190
Length 467 bp
Fasta Format > whoh10d21
cgccgacgtgctgctgggcgtgcacggcgccggactgaccaacatgatgt tcctggcgccgggagcgacgatggtgcaggtggtgccgtggggcgggctg cagtggatcgcccgcatggactacggcgacccggcggaggccatggggct ccggtacgtgcagtacgagatcggcgtggaggagagctcgctcaaggaca agtacccgaggggacacaagatcttcaccgacccgacgtcgctgcacaag aagggcttcgggttcatgcgccggacgctcatggacggccagaacatcac cctcgacctcggccggttccgcggcgtgctccagcaggcgctcggcaact acctcgtgcagtagtccgacatagctagaatgaatgaatataccgtatat gcatcatgtatatgtatacacacatacttccattatttttcatttttcag tctgccagattaaatgt
Download
page-top