Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267189
Length 448 bp
Fasta Format > whoh10d20
agatccgacgaccccaggtcggaatcggggagctgccatgggttcacaga acatcggccccagagatgtctgcatcgtcggggtcgcgcgcacccctatg ggtggtttcctcggcgccctgtcttccttgcctgctaccaaactcggctc cgtggctatcgaagctgctctgaaaagggcgaatgtcgatccatcccttg tgcaggaggtcttcttcggcaatgtcctgagtgctaacttggggcaagct ccagcgagacaggctgccttaggcgcagggataccgaacacggttgtttg caccactgtcaacaaagtttgcgcatctggcatgaaagcaacgatgtttg ctgcacagtcgattctactgggcagcaatgatattgtagtggcaggtggc atggagagcatgtcgaatgctccgaaatacatttgctgaagctagaaa
Download
page-top