Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267185
Length 333 bp
Fasta Format > whoh10d11
aggaaagaaacagatactggagcacctattaaattggatgcagaagctca ngctcacattgagaagcataggaagctgcaagaagatctaactgacgaaa tggttgacttagcacgccagctgaaggagagtagccttttaatgaaccag tccgtgcaagatacanagaagatcctcgattccacagagagagccgtgga gcatancctggncagcaccggncgtgcaacggngcgagcctcanaggtct actctctggcctncaagacaacctgcttccagtggttgctcatcttttta atgacgtgcatgtttgncatggtggttctcctc
Download
page-top