Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267180
Length 524 bp
Fasta Format > whoh10d05
gccgcagcggcgcatcagcgcctgcgtgcgtgcgcgtatatgaacgcacg ccccgttctgactcttgagtcctcctcgccacaccaacagacgcagccaa cagcgctccctctgaaaaaaaaaagagaacagcaacgggaataatctcct ttcctcctcgtccgcgtgcgatcgacgcggaggcgccgcccgtccccctc ccctccgctccgacccgaccccatggccttcatgcgcacctcctccaatg catcctntggcatgggagttgctcctgatatcagggagacattcctggag cttcagatgaagaaggcatttcgctatgttatcttcaaaatcgaagaaaa gcaaaaacaggttgttgnggagaagacaggggctacaactgagagttatg atgatttcctggcttgtctcccanaaaaggactgcagatatgccctttat gattttgactttgttactggggagaatgtgcagaaaagcaagattttctt cattgcctggtcccctgacacatc
Download
page-top