Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267172
Length 465 bp
Fasta Format > whoh10c01
cgcgcctccacctccgccgaaatcgccatggcgcccaaggccgagaagaa gcccgcagcggagaagaagccggtggagacggagaagaagcccaaggccg agaagcgcgtgcccggcaaggacggcggcgccgacaagaagaagaagaag gccaagaagagcgtcgagacctacaagatctacatcttcaaggtcctgaa gcaggtgcaccccgacatcggcatctcctccaaggccatgtccatcatga actccttcatcaacgacatcttcgagaagctcgccggtgagtcggccaag ctcgcgcgctacaacaagaagcccaccatcacctcccgggagatccagac cgccgtccgcctcgtcctccccggcgagctcgccaagcatgccgtctctg agggcaccaaggccgtcaccaagttcacctcctcttagatctccagccgc cgcggagtctctgtt
Download
page-top