Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267171
Length 567 bp
Fasta Format > whoh10b24
gcacagcaaaacccaaaaagacctttaaaccatgcctatatataatatca tgcaaattcttggtttttattagtttcacatgctaaagtatatagtttga acataggtatttcaaatgtaaaagttttagaattattacctcgagtgctt gctaaaacccgaagttactaacaaatgcaaatatttcttgttataaaagg tttagaattattacccgagtgcttgctaaaacccgaagttactaacaaat gcccacaactaaaccaactaaaacatggtgtttttcaccgtgcacatgga ttcagcgtctctacgccatatgcccttgcaaaatgagactattttcatcg acaacatggctttagcgggtctctgcgccatttggcgcgattcagtttta gtttttcactcagacatacagttgttagtgttgttaatccatacatagta gtatctgtaacttgatgttatcgtatctttcattcaagatcttgtgcaag attacatgcatattttcctttgctgtagacccatgttgatttctggaccc aaattctaatgggtctc
Download
page-top