Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ267163
Length 593 bp
Fasta Format > whoh10b09
gcagtaagcacacgcgcagtacagattggaaccggagtagctcgatctga tagcacaagctttcgaatccctttcggcggaaggaatggcggaggagaag gggacgctgcaggcgatgagggggtgggtcgtggaccacaagctgcgggc cgtagggacgctgtggctcacggggatcgcgggatccatcgcctacaact ggtccaggcccgggatgaagaccagcgtcaagctcatccacgccaggctt cacgctcaggccctcactctggctgccttgggttgttctgcgcttgtgga gtactatgatcaccagtcaggttcaggatcaaaggttcacgactatgcaa agcagttccttccatcggacagaaacgccaaaaaggactccgtgtagaag aggcagcaagttataatataggcttccattagctgatatggaatttgttg atgttattttctgagcaaacaatctggcatttcacatgccgttatccaag ttctgcaggcttcctgttctctgtataagctacccgaaccagcatttaga tgcagccgtatgcaaatccgtggggatggaaatatgtgctttc
Download
page-top