Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208692
Length 453 bp
Fasta Format > wh10f17
cgagggtccgggcgcggcaagggaggcaaggggctgggcaagggcggcgc caagcgccaccggaaggtcctccgcgacaacatccagggcatcaccaagc cggcgatccggaggctggcgaggaggggcggcgtgaagcgcatctccggc ctcatctacgaggagacccgcggcgtcctcaagatcttcctcgagaacgt catccgcgacgccgtcacctacaccgagcacgcccgccgcaagaccgtca cagccatggacgtcgtctacgcgctcaagcgccagggccgcaccctctac ggcttcggaggctagtagatacgtggtgtgctctgctggtggcggccgtg tttttctgtgttatatgtgccgtggtggatgggatgtacttctctgtcgt gcgtttgtgttcactagtctgcaataccattatccgttcaatgaaaaaaa aaa
Download
page-top