Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ263789
Length 617 bp
Fasta Format > rwhh6d20
cagtcctaatgggaccgtaacaaacataacgaactcaaaagcagaaagaa catttttacttgtctcaaggatctgaagagagtcgttgacaggaaaggca aaacatatgctccatagcccatacagttatacccagaataccaatatgat actaatacattgttcgagtgggaagttctggcacaacactgaacaaaaca gggatatcatcagcttagaagagagaggtccccttgcccttcttgtctcc accgatctcaaagtgcttgcacctcttgatagcgcgttgcgagtaatgct tgcagctctggcactgcagcttcagcacaatcttctttgttgtcttggcc ttcttgtggaaaacaggctttgtctggccaccatatcctgactgcttgcg gtcgtaacggcgctttccctgagcagaaagactgtccttgcctttcttgt actgcgtaaccttgtggagggtgtgcttcttgcactccttgttcttgcag taggtcttcttggtctttggaacgttcaccatggtcgccgcctggaagct ctcctccgcgcgtctgcttcttctcctggcggcgtgggcggcggtgagga aagggggaagggggagc
Download
page-top