Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whpc_19047_a10r
Length 738 bp
Fasta Format > whpc_19047_a10r
ACATTCGCAGCAGCTCAGAGTTGCAATTGCAATGCATAAACCGGTTCCCA AACAATCTGCCACAAAGCAAGAAAAAAAGCTGGTAACACTATGGGATAAG ATCTGTCGCAGCCTAAGCCTTGAGCCTGCCGTAGAACTTCTGCTTCTCGT CAGTGGTCTGGAACCGGCCATGCCCGAACTTGGATGAGGTGTCGATGAAC TTGAGCTTGATCTCCTCAAGGGCCAACCGCGAGGTCTGCTTCAACAGGGA CTGGCGGAGGGTCACCACTCTCTTCTTGGGGCCCACACAGCAGCCCTTGA TCATGAGGTAGTCACCCTTCACCACACCATAGTGAGGGAAGCCACCCATC GGGGTGATGTCCTTCTCAGTCCTGTCAAACTCAGTGCAGGCCTCGTGAGA CTCCTGTCCAGACTTGCCCATCTTGTAAATCTTTTTGTTCATCTCTGTGC GGTGGTGGTAACCATTCTGACCAGCACGAGCAACAGTGTAGGAAACCCTA GCAGGATGCCAGGCACCGATACAGGCAACCTTTCGGAGACCCCTGTGGGT CTTGCGGGGAAGGCGGGTCACACCCCAGCGAGTGACGACACCTTCGTACC CCTTACCCTTGGTGACACCAATGATGTCAACCATTTCATCTTTCTGGAAG ACCGCTTCAACTGGGACTTCCTTCTCAAAGAACTTGTAGCCATAGTCAAC CTTGTCTGCGATGGTGCCACCATTAACCTGGATCTCCA
Download
page-top