Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whpc_9032_a07r
Length 416 bp
Fasta Format > whpc_9032_a07r
TATATAGTATAGAATTACATGAAGCATCAATTGCTTGTCTCTCAATTCAT TTGTGCTGCTACTGCTACCTGTGACTGTGTAGGGTAGGGAACTAGGGATG ATCCAACTTAATTCGGCTGGTGAGTGGTGATGGCTTGGTGGTTCCCTTAG TTAGTATGTGACCCTGACGCCCTGGTAGCGGAGGATCTCGCCGATGAGCT CGCCCTTGCCGGAGCCGACGTAGCGGCCCACGATTTTCTTGTCCCTGATG AAGAGGAAGGTGGGCACCTCGACGACCTCCATGTCCTTGAGGAACTGCAT GCATGCGTCGTTCTCGTCGCCGTTCATGCGCGCGAAGACGGCGGTGTCGG CCATGGAGCGGGAGAGCTTGACGACGGTGGGGTAGACCTTGACGCAGGGC CCGCAGTGCCTCGTGC
Download
page-top