Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whpc_4032_a07f
Length 707 bp
Fasta Format > whpc_4032_a07f
CGTCCCCTCCCTCTCCTGTCGCGTGCGCTCGGCCAGCAAAAAGCTTCCAC ATAAAGGCCAACAAGAGAAACCATAATCTGTTGGGTGCCAGTCAAACCTC AACAACAAAGTTTCATGTCTGATCTCGACGTTACTCTGCCATCTGCCTTC GATCCTTTTGCTGAGGCAAATGCTGAGGATGCTGGTGCAGGCCCGGGCGC AAAAGATTATGTGCATGTGCGCATCCAGCAGCGCAACGGCAGGAAGAGTC TGACCACTGTCCAGGGCCTGAAGAAGGAGTTCAGCTACAACAAGATCCTC AAGGATCTCAAGAAGGAATTCTGCTGCAATGGCACAGTAGTCCAGGATCC AGAGCTAGGCCAGGTCATTCAGCTTCAGGGTGATCAGCGTAAGAATGTTG CTACTTTCCTAGTCCAGGCTGGAATTGCGAAGAAGGAGCTCATCAAGATC CACGGCTTCTAAGCTGAAGCCGCCTCCGATAAATGCCCGAACCGCCAGCC GGTTCTACTCTATATTGAAGACTTAAGGCATCTATATTGCCGCCCGCTTG TTGAACCGGTTTCTTGCTTGATGCAAGTTGTGTTGTCACCTGGTTATTAT GCTGCTGCTGTACCAGCATATCAGTATGGTTTGTCTAAAGATGTTGCCGA CTAAATAAAAATCCGTATCGTTTGGCTATGACTCTCATTTTGGTCCCAAA AAAAAAA
Download
page-top