Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whok_10020_m08f
Length 764 bp
Fasta Format > whok_10020_m08f
GGCCCCCACCGTGATGGCCTCGTCGGCCACCTCCGTCGCTCCTTTCCAGG GGCTCAAGTCCACCGCCGGCCTCCCCGTCAGCCGCCGCTCCAACGGCGCT AGCCTCGGCAGCGTCAGCAACGGTGGAAGGATCAGGTGCATGCAGGTGTG GCCCATCGAGGGCATTAAGAAGTTCGAGACCCTGTCCTACCTGCCACCGC TCAGCACAGAGGCCCTCCTCAAGCAGGTCGACTACCTGATCCGCTCCAAG TGGGTGCCTTGCCTCGAGTTCAGCAAGGTTGGGTTTATCTTCCGTGAGCA CAACGCATCCCCTGGGTACTACGATGGCCGGTACTGGACAATGTGGAAGC TGCCTATGTTCGGGTGCACCGACGCCACGCAGGTGATCAACGAGGTGGAG GAGGTCAAGAAGGAGTACCCTGACGCGTATGTCCGCATCATCGGATTCGA CAACATGCGCCAGGTGCAGTGCGTCAGCTTCATCGCCTTCAAGCCACCGG GCTGCGAGGAGTCCGGCAAGGCCTAAACAGCTCACTCACCACGGGCCACA TATAAAGTGCCATTGCGGTTTTGTCAACTCTGACATTGCTTTGGGTTTTC CTTTTCCATTTATCTTTCTTGTTTGTTCCTAAGATAAGAATATGTGTATG TCCATGTTCCCGACATGACTNNAGAAAGCATGCTCGTATGTGAATGCTAC CGATGGCTATGTATATGCACATGCACATAATATTATAAGTACAATCTGTC GACTAAAAAAAAAA
Download
page-top