Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whok_2056_j16r
Length 714 bp
Fasta Format > whok_2056_j16r
GCAGACAGGAAAAACATCCGGCTTGACTACTCCATATCAAGCCTTCAACC TAAAACCGACTCGCATAGTCTCTGGCTCTCAAAGTATTGATTGATAAGAC AGACTCATGATCCTCTCTCTACTCGATCAGATCGTCATCGTCATCAGGCA GTGGCTGTGCCGCTGCAGCCGCAAGCTCAGCCTCGTGCTGTTGCTGCATG GCCAAGTCGAAGGTCACTTCCGGAGGCTTAAGGGCCACTGCTTCGACGAA GTGGATGTTGGGATCACCAGCCAGCTTCCTAGCAAGGTAAAGGAAGGGCT TCTCAAAGTTGTAGTTGCTCTTGGCAGAGATTTCATAGTACTGGAGGTTC TTCTTCCTGTGGAATGTCACCTGCTTGGCCTTAACCTGCCTGTTCTTCAC ATCAACCTTGTTGCCACACAGCACAATGGGGATGTTCTCACAAACCCTGC ACAAGTCCCTGTGCCACGTAGGAACATTCTTGTAGGTCAGCCTTGAAGTG ACATCAAACATGATAATCGCACACTGACCATGGATATAGTATCCATCCCT AAGGCCACCAAACTTCTCTTGCCCAGCAGTGTCCCAGCAGTAGAAACGGA TCTTTCCACAGTTAGTGGTGAAATCCAACGGGTGAACTTCAACACCAATG GTGGGTTCGTATTTCTTCTCAAACTCTCCAGTGAGATGCCTCTTCACAAA TGTGGTTTTGCCAG
Download
page-top