Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ266295
Length 664 bp
Fasta Format > rwhh25o07
gcatccttancgaccgnaaacatcatctaagtgcttaaccaaaacttcca catgcaaaaatcttcaaactcttacacgctaaaacacacaggccagtaga gtagggacccgctcacatgaagaggttgggcctcgtcgccttgtaggtgg tcttgagcttgcgggtgggtgggcgaaccttctggtacaccagcgggaac ttgatcttcgagttgtggaactgcttcgtgttgtccctcttgcacagctt gaagtccaccgtcgcagtcttgatgatctggatgcagggggcacgcacgc ggtgccgcgacgccatctccgtgtacatctgctccaccccgccgttgagg gtcgtgtcacggtactccttgtacatgttgtggtaaccggtcctgctctg gtacctcagccagatgccgtagttcttgattgtggtggggttcttctcaa agatctcgttgatggcgagcatctggccgttggccttcttcaccttcttg agcttcctcaggaagtaccagaacttggacttggcgcggacctcattggt ggcccagagcttcatgcggtagatcttgggctgctcatcgccgggggccg gcagcgcgcgacccaccacctggtactggtggaacctgtgggcgaccatt ctggcgagctctcg
Download
page-top