Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ262381
Length 612 bp
Fasta Format > rwhh18h22
ctcgacagggnaataacaattcaacacggaaaggaactacataacacttg gcagttcatactacaagcacgcccatcacaagacacgaggcgtcaaagca aaacaatgcaacaccccatcgaccgacccatctaatccaagtccagacaa acacatgacatccttattgctcttcttcttcatgatcttcttcttcttct ccattaacgaccttcaggcgccgagcttgaatcagcagcagccctcaaca gcctcgccaaatcccaattcggatagcttgaggtgtgcctcagcgtagtc agcaaagaaagcatcctcatccgcagcatatttgtccacaagtgggcgga aggccgggtcagtcaggagggtcttgtcggtcggcaactgaagaaggcct tccttctccccacaaaggagctcagtgaagtaagagttgtcgaagatcaa agggttggcagtccaggctccctcaaagccggacctctccttgtggcatc ttcccagggtgtgaccaccagaaagagcaacaatgtcctggtcactcaaa cccattctgagtggaaaacacctgcctgaggtggtcagagcccttgggta gcatcaggaaga
Download
page-top