Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ262341
Length 521 bp
Fasta Format > rwhh18f10
cattaagagngcccgtagcatttttaaaagacatggatacagccccggcg ccatacgggcaaaaatcagcttcatcgataacaccgccaaaaccccaaag agcgggcangcatcttgatcttgggtcccaaaaaagcttgctgcccaacc tatcttactgttgtgcgcactgcactctttgggcaccgcctccaggcatc tcgtcgtcctcatngtacgcctcctgagcagcagcatgggctttccgacg catctcctcctccatgttgacgtcatgcattgtcgtctcctcgcattcat cgagctccatgtcggtcagcttggatgcaggctttggtggaagcacagcc tcgagagccttgcactgatccggtgccagcgagtcgggaaactccaccgt gaaangaatgtagagcttgcccttcatgaaaggcctctggtacatcggca tcccctcgtcgctgattgccttgaatgaatcaggcttgacaacttcacca gggtttgatttaatgagcagc
Download
page-top