Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208224
Length 389 bp
Fasta Format > wh7f08
ggtgacacgaccctcaacggcggggtggagcagatgtacacggagatggc gtcgcggcaccgcgtgcgtgccccctgcatccagatcatcaagactgcga cggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaac tcgaagatcaagttcccgctggtgtaccagaaggttcgcccacccacccg caagctcaagaccacctacaaggcgacgaggcccaacctcttcatgtgag cgggtccctactctactggcctgtgtgttttagcgtgtaagagtttgaag atttttgcatgtggaagttttggttaagcacttagatgatgttttcggtc gctaaggatgctgctgctttgatgcaactcttgactttg
Download
page-top