Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257982
Length 589 bp
Fasta Format > whh5f20
tcgccagnaatggtcgcccacaggttccaccagtaccaggtggtgggtcg cgcgctgccggcccccggcgatgagcagcccaagatctaccgcatgaagc tctgggccaccaatgaggtccgcgccaagtccaagttctggtacttcctg aggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa cgagatctttgagaagaaccccaccacaatcaagaactacggcatctggc tgaggtaccagagcaggaccggttaccacaacatgtacaaggagtaccgt gacacgaccctcaacggcggggtggagcagatgtacacggagatggcgtc gcggcaccgcgtgcgtgccccctgcatccagatcatcaagactgcgacgg tggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcg aagatcaagttcccgctggtgtaccagaaggttcgcccacccacccgcaa gctcaagaccacctacaaggcgacnaggcccaacctnttcatgtgagcgg gtccctactntactggnctgngtgntttancgngnnaga
Download
page-top