Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whhg_9015_a02r
Length 31 bp
Fasta Format > whhg_9015_a02r
TCATCAACACCCTCATCATCACCACCACCCT
Download
page-top