Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ255951
Length 709 bp
Fasta Format > whh3c04
gcacagnacccctcccctcccctcccctcccccaacccaccggcggcggc gcagcgcagcttgaggaaggaagcgaagatggtgaagttcctgaagcccg gcaaggcggtgatcctgctgcagggcaggtacgcggggaagaaggcggtg atcgtgcgcgtgttcgaggagggcacccgcgaccgcccgtacgggcactg cctcgtcgccgggctggccaagtacccgaagaaggtgatccgcaaggact cggccaagaagacggccaagaagtcccgcgtcaaggtgttcctcaagctc gtcaacttcacccatctcatgcccacccgctataccctcgacgtcgacct caaggaggtggcctccggcgcgcccgactccctcacctccaaggacaaga aggtgggcgccgccaaggccgccaaggccaagctcgaggagaggttcaag accggcaagaacaggtggttcttcaccaagctccgcttctaggccggccg gccgcgccagggcggtctctgccgttattactacccgaaccctttacatt tttagttgcttgttatcggtgactgttgctgcgcttaaggtgtcctgttt tggtattgcccatgaagaagactctgtgtttagcttggatcttatgagat atgatgatgtttcatgtgttaaatcatgtgaagaatagatctttgttgga aaaaaaaaa
Download
page-top