Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208685
Length 615 bp
Fasta Format > wh10f03
tggctccgattggcgtgggcagcaccctccccgacggccagctcgcgtgg ttcgacgagaacgaccagatgcagcaggtctccatccactcgttggccgc cggcaagaaggtcatcctcttcggcgtccccggtgccttcacccccacct gcagcaatcagcatgtaccaggcttcattactcaggccgaggagctcaaa gccaagggtgtagatgagatcctgcttgtcagcgttaatgacccctttgt catgaaagcatgggcgaagacatacccagataacaagcatgtgaagttcc ttgctgatggagcggctgcatacacaaaagcacttggtcttgagcttgat cttacggagaaaggattgggtcttcgttcgaggcggtttgctctccttgc tgacgacctcaaggtcaccgtcgcaaacgtcgaggaaggtggccagttca caatctctggtgccgaggagatcctcaaggcactgtaggggcttcagcgc ttcggaatcgcagcgatcacccaaaccttgtgtcatatcgatgtagtttg aacttgtctgccaaactgctagtgggaataaattgtcgatgtgcatttct tcatgtactttatgt
Download
page-top