Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ260603
Length 614 bp
Fasta Format > whh25o07
gggtttcagttctcctccgcctccggtctcgagnagctcgccagnaatgg tcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccggcc cccggcgatgagcagcccaagatctaccgcatgaagctctgggccaccaa tgaggtccgcgccaagtccaagttctggtacttcctgaggaagctcaaga aggtgaagaaggccaacggccagatgctcgccatcaacgagatctttgag aagaaccccaccacaatcaagaactacggcatctggctgaggtaccagag caggaccggttaccacaacatgtacaaggagtaccgtgacacgaccctca acggcggggtggagcagatgtacacggagatggcgtcgcggcaccgcgtg cgtgccccctgcatccagatcatcaagactgcgacggtggacttcaagct gtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcc cgctggtgtaccagaaggttcgcccacccacccgcaagctcaagaccacc tacaaggcgacgaggcccaacctcttcatgtgagcgggtccctactctac tggcctgtgtgttt
Download
page-top