Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ260570
Length 514 bp
Fasta Format > whh25l09
gttaggtttagttctcctccgcctccggtctcgagnagctcgccagaatg gtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccggc ccccggcgatgagcagcccaagatctaccgcatgaagctctgggccacca atgaggtccgcgccaagtccaagttctggtacttcctgaggaagctcaag aaggtgaagaaggccaacggccagatgctcgccatcaacgagatctttga gaagaaccccaccacaatcaagaactacggcatctggctgaggtaccaga gcaggaccggttaccacaacatgtacaaggagtaccgtgacacgaccctc aacggcggggtggagcagatgtacacggagatggcgtcgcggcaccgcgt gcgtgccccctgcatccagatcatcaagactgcgacggtggacttcaagc tgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttc ccgctggtgtacca
Download
page-top