Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ260568
Length 129 bp
Fasta Format > whh25l07
gngacgggttctgaaacctgggatgcgcaaggaaagctgacgagcgggag gccctcacgggccgcaccgctggccgaccctgatcttttgtgaagggtnc gagtnggagcacgcctgtcgggacccgaa
Download
page-top