Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ260334
Length 605 bp
Fasta Format > whh24i05
ggtctgagtttttgagtgaccctganaagcgtgagatctatgatngtatg gcgaagatgctctcaaggaaggaatgggtggaggaggaggtggtggagtt gatccatttgacatcttctcatcatttttcgggccctcttttggaggtgg tggtggcggcagcagcaggggcagaaggcaaaggaggggagaggatgttg tccatccacttaaagcttctctagaagatctttacaatggtacctcgaag aagctctctctttcccgtagtgtcctctgctccaagtgcaagggcaaggg atccaagtctggtgcttccatgaggtgcccaggttgccaggggtcaggca tgaaagtcactattcgtcagctggggccttccatgatacagcagatgcag caggcctgcaatgattgcaagggcaccggggagagtattaacgacaagga tcgctgcccaggctgcaagggtgagaaggttcttcaggagaagaaagttc tggaggttcacgttgagaaggggatgcaacacaaccagaagatcaccttc cctggtgaagctgatgaggcgcctgacactgttactggagacattgtatt tgtcg
Download
page-top