Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257224
Length 609 bp
Fasta Format > whh20g20
aggaattcggacgagggtctgactgcgtgcgagtcgacgggttctgaaac ctgggatgcgcaaggaagctgacgagcgggaggccctcacgggccgcacc gctggccgaccctgatcttttgtgaagggttcgagttggagcacgcctgt cgggacccgaaagatggtgaactatgcctgagcggggcgaagccagagga aactctggtggaggctcgaagcgatactgacgtgcaaatcgttcgtctga cttgggtataggggcgaaagactaatcgaaccatctagtagctggttccc tccgaagtttccctcaggatagctggagcccattacgagttctatcaggt aaagccaatgattagaggcattggggacgcaacgtcctcgacctattctc aaactttaaataggtaggatggcgcggctgcttcggtgagccgtgccatg gaatcgggtgctccaagtgggccatttttggtaagcagaactggcgatgc gggatgaaccggaagccgggttacggtgcccaactgcgcgctaacctaga acccacaaagggtgttggtcgattaagacagcaggacggtggtcatggaa gtcgaaatc
Download
page-top