Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ255681
Length 615 bp
Fasta Format > whh1o14
ggcgtcgcccaccacagnancacacgagtcgacgcgccgcgacagctcag ctctttcgtctcgtctcgcctcgcctcccccgcccccttccagtcccctc cggcgcgcgagcgagatcgatcgcgccggaccctagatcccgatggcctc tcgccgccgcaccctcctcaaggtcatcatcctcggcgacagcggggttg ggaagacttccttgatgaaccaatatgtgaacaagaagttcagcaaccag tacaaggctacgattggcgccgatttcctcaccaaggaggtgcagttcga ggacaggctcttcaccctacaaatatgggatactgccggtcaggagaggt ttcaaagtcttggtgttgcattctaccgcggtgcagattgttgtgttcta gtttacgatgttaactcaatgaaatcatttgataatctgaacaactggcg tgaagagtttctaattcaggctagcccatcagatcctgataacttccctt ttgttctgctgggtaacaaagttgatgtagatggcgggaatagtcgcgtg gtttctgagaaaaaggcgaaggcatggtgtgcctctaaagggaacatccc atactttgagacttc
Download
page-top