Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ208683
Length 588 bp
Fasta Format > wh10e22
tcggcacgaggcttgaagaaattttgcagtcacaggatcagtatattagg gacgtgcttggtaattcgctagttccaaaggcagcggcaacatcagatat ggtcgttatctgcgaggagtctcatactgtacatgacatgtcatttgtca tctacattgcaagatgcatgcctgtgctcgcagctgatctcctttcctat gcctcaggcaacagtgaccacgttgaggcgttaagagtgtatttgctgtc aaggtccatttccagattgaagaacgaattccagactggaaatggcaaga ttacggtcaggtgcatcgaaggctatcccccaattgatctgcagctaggg aagcatgttttccttagcgctggcgatttttaccaggctaaccgctcttg attcttgtctccgagcatcccagttttgagtagttttgtcattttcaacc gcaattcattctaatcaggctgattctgtttgtgcctcacaaaagcaatg tatttacttaaatgtgctgccaaggatcgaagggaaagggaattgtcaat tgtgtattcagagactcatgtgtatgaagtattacagt
Download
page-top