Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whem_15016_a04f
Length 495 bp
Fasta Format > whem_15016_a04f
GTATGGATTATTGGGTAAGAAAATAAAAGATACATTTGGTCACACAGGAG GAACGGCATTAGGTGGGCTTGTGGGATTGAAGGAGCCGATCAACCATGGC GTACCTTATTCATTGACTGAAGAGTTTACCAGTGCTTACAGAATGCATTC CTTAATACCAAGCACTCTCAAGCTCAGGGATCCGACCGGGCAACCCGCTG CAAATAATTCCCCACCGTACCTGGAAGACATCGATATTGGAGAGTTGGTT GGTCTCAAGGGGGAATACCAGCTATCAAAAATAGGGTTTGAAAAACAAAC ATTATCAATGGGATATCAAGCTTGTGGTGCACTTGAACTATGGAACTACC CAAGTTTCTTCAGGGACCTTATACCACAAAATTTGGATGGTACCAATCAA TCTGACAGAATCGACCTTGCTGCCCTAGAAGTATACCGAGACAGGGAGAG AAGTGTACCGAGGTACAATGAGTTCAGGAGGAGACTATTTTTGAT
Download
page-top