Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ259039
Length 663 bp
Fasta Format > whh14k10
ccgcacaggccgcagcagnancgccatgtcgtcctcccctacccccgcgc cagacgccggcgccgccgcgatggccgtcgacgactcgtcggagaccgac cagctcgactccatgtccacggaggacatcgtccgggccacccgcctcct cgacaacgaggtccgcgtcctcaaggacgagctgcagcggaacaacctgg agctcgagaacgtcaaggacaagatcaaggagaaccaagagaagataaag ctcaacaagcagctgccctacctcgtcggcaacatcgtcgagatattgga aatgaaccctgaagatgaggctgaagaggatggcgctaatatagatctgg actcacagaggaaaggaaaatgtgttgttcttaagacatccacaagacag actatattccttcctgtgatcgggctagttgaccctgataacctcaagcc tggtgatttggttggagtcaacaaggacagctacttgatattagacacgc taccttcggagtatgactctcgagtaaaggcaatggaggtagatgaaaag cctacggaggattataatgacattggtggccttgagaaagagattcagga acttgttgaagctatagtgttgccaatgacacacaaggagcaatttcaga agttgggaatccg
Download
page-top