Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ258958
Length 708 bp
Fasta Format > whh14f04
attcggacgagggccccctaaccnaaccctaccccgccgccgccgtcgcc gccgcagcgcgcggaggcgacctcgcaccgccgccaagatgcagatcttc gtgaagaccctgacgggcaagaccatcacgctggaggtggagtcctcgga caccatcgacaacgtcaaggccaagatccaggacaaggagggcatcccgc cggaccagcagcgcctcatcttcgccggtaagcagctcgaggacggccgc accctcgccgactacaacatccagaaggagtccaccctccacctggtgct ccgcctccgcggcggcgccaagaagcgcaagaagaagacctacaccaagc ccaagaagcaaaagcacaagcacaagaaggtgaagctcgccgtcctccag ttctacaaggtcgacgacgccaccggcaaggtgaccaggctcaggaagga gtgccccaacgccgactgcggcgccggcaccttcatggccaaccacttcg accgccactactgcggcaagtgcggcctcacctacgtctacaaccagaag gcttagaggtggcttcgcgtttgctctgctctttttacctacctatcgag aatcgaactcatttagatgtgtcccgtttgtcttttaaactgaaaccttg agtatcatgtttcctgaatatttcatcgcatactgctgtagtgcgatgcg tgcttaaa
Download
page-top