Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

This sequence is the data used during the creation of complex contig (registered : 2012 - ), before an accession number is assigned.

Fasta Format

Clone name whe_25055_m04r
Length 548 bp
Fasta Format > whe_25055_m04r
AAATTTTACGTCCCTGGCACGCCCAGGAAGAACAAGTGTAGATGAACAGC ACAGAGGGGATTACAATTATTATGTAAAGGGGCTATCCCAGGACAACACC CCAGCAGAATGCACACGAAAATTACATGACTGTTAACTCAGCGAAGGAGG ACAGGAAGGTTTCTGGGAACGCGACTGGCGATGCAGCAGGCGTCACTCAA AGATCCTCGGGGCCGTTGATGTCCTTGTTCTCGAGCACAGCTCCGTCTGG GATCTCCAACTTGACTCCAGCCTTGGCTGCGATGGTCACGTTGCCCTTGA GCACGACTCCAGAGCCAAACGAGACATCGCCAGAGACCTTCAAGCTGTCG AGCTCAACAATGCTGGGGATCGACTTGAAACGGGCAAGGAAGTTGGCAAC CTTTTTGAACTCAGGACCAAGCTCAATTGAAGGGTTCGATGGCTTCACTC TGGCTGGGTTGCGGATGACGTAGCCATCGACNNNNNTATAGAGATCAGAC TGCACAAGCAACAAATCAGATGTAGCCTTCACGGGCAGAAACCTTGAG
Download
page-top