Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257422
Length 657 bp
Fasta Format > whh10h05
actgatgacagnacatggagctgctgtccgattgcccggtgcacacctcc gtgccggacaagtacgtgttgcccccggagaagcgcccttcgctcctcga cgacgaacccagctccgatgttgccataccggtcatcgacctccacggcg ccgccgtctccgacgactgccggcgccagctggtcgccgccaagatcatc aaggccagcaaggagttcggcatcttccaggtggtgaaccacggcgtggc ggaggtcgtggtgcaggggttccgcgaggcggcggcggggttcttcgcga tgccggcggaggagaagctgccgtacctctccgatgaccagagcaagcac ttccgcgtctcctccagcaccccctatgaccggaacggggaccgctattg gctggactacctcaagatcaactgccaccccgtcaccgacgagcacgtcc gagagtggccgaacaagccggaaagcttcaggagctccctcgccgagtac tccgcgacggtgcacgagcttgcacagacgctgctccggctcatcgcaga ggggctcggcctcgacgatggattcttcgccggcgacctcagcggcggca gcacccagatgaacgtcaactactacccgtcgtgcccggacccgagcctc acgctgg
Download
page-top