Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257417
Length 597 bp
Fasta Format > whh10g19
ggcggagtagggtttcacctgcatccttctcaacgttagcaggagcgagt gggagtccggccatggcgccgtcgcagcccaagtcagggctcttcgtggg catcaacaagggccacgtcgtcaccaagcgcgagctgccgccacgcccgt ccgaccgcaaggggaaaggtaccaagagggtgcattttgtcaggaacttg attagggaggttgctggattcgctccctatgagaaacgtatcactgagct tcttaaggttggaaaggacaagcgtgcactcaaggtcgccaagagaaagc ttggtactcacaagagagcaaagaagaagagagaggagatgtcaagtgtc cttaggaagatgaggtctgctggtggtggtggtgctggtgacaagaagaa atagagcgtggctagttggtgaattttatccgaaaactcggtcctgtatt accagtccgtacctatagagctatggccattgtgttggattttggaacta ttaaatttgacgctcttaagcccgtggtttctattctgagaagaccaatc tttttaagatttttagtttggngcctttgttttattattacttgctt
Download
page-top