Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257414
Length 376 bp
Fasta Format > whh10g14
ctcacactctctgntnagnagtagcactagcttcagctagccagcctctg ccactccggtcattttcttgcatccacgacggcaatggccaccgctgatg tccagaacccatcggccgcgctgacggaggaggcgcccgcggtggagaag ccggtcgccgccgaggaggtcgcgtgacgtgggctaaataaaagtgttgt cggggccagtcgacgcccagtgtcgggtcagcagcgagcgagcgagcgac gcagcgccactcgccggcacccgtgtgcctgcgtctgctcagctggagct ttgttgcggtgtgtgtcacagtgtcagttccacctatgatcgatcggtat cctatccggtttgtgtaaaaaaaaaa
Download
page-top