Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257413
Length 696 bp
Fasta Format > whh10g11
gcggccttcgtgccggcgacgcatcattcaaatttctgccctatcaactt tcgatggtaggataggggcctaccatggtggtgacgggtgacggagaatt agggttcgattccggagagggagcctgagaaacggctaccacatccaagg aaggcagcaggcgcgcaaattacccaatcctgacacggggaggtagtgac aataaataacaataccgggcgcattagtgtctggtaattggaatgagtac aatctaaatcccttaacgaggatccattggagggcaagtctggtgccagc agccgcggtaattccagctccaatagcgtatatttaagttgttgcagtta aaaagctcgtagttggaccttgggccgggtcggccggtccgcctcacggc gagcaccgacctactcgacccttcggccggcatcgcgctcctagccttaa ttggccgggtcgtgtttccggcatcgttactttgaagaaattagagtgct caaagcaagccatcgctctggatacattagcatgggataacatcatagga ttccggtcctattgtgttggccttcgggatcggagtaatgattaataggg acagtcgggggcattcgtatttcatagtcagaggtgaaattcttggattt atgaaagacgaacaactgcgaaagcatttgccaaggatgttttcat
Download
page-top