Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257400
Length 716 bp
Fasta Format > whh10f15
ttcggcacgaggcgtcgacatgtctgcctcgtcctcgacctcacagtccc tcgcacccatcctccaagagcagcctcctcttcctctcatccgttgcccc tggtgccacaacggcgacatcgagtggtgggtttcccggactcccaagaa ccccgggaaacacttctacaagtgcgagcgtcactgggttagtgaatact tttcctgtcccggattgatcatgttattcgaagggaaactctgcatgccg gtcactgcagatccaccccaccccgcacataaacatcgatggattcgggt gcgagccggtcactgcagatccagcacgggctgagactttggggatgaag gtcggcgactaggcaaggatcctcggcggcttggtgttgagtctttcctc gtattttctctctgcaaatttttgtttctcaaattttctctctgaggtgt tgtgatcgtattttctttccttgttttttctctgaaaatttctttcctaa aaatttctcgctgaggttttctgtttttttcgccaactctgacaccattc ggtatgcaacggcggcggccagcagcagaagtacgcaacgctagccgctg gggcagtgattgcttgtggcggcgagaagcgagcagcagctgcagtacgc ggagctggggcaggggcagcccgtgtcggcgagcagcggcagcccgtggc gtcagcgagcagcaag
Download
page-top