Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257397
Length 618 bp
Fasta Format > whh10f08
ggccgccgacctcgcgtcttctcctgcgcatctcggaggtgcttcctagt ttccacgatgaagctgatcgctgcctacctcctcgcctatctgggtggga actcttccccaagtgccgctgacgtcaagaacatcctggactcagttggt gccgaggctgatgaagaaaagcttgagttccttctggctgaactcaaagg caaggacatcacagaagtgattgcatctggaagggagaagtttgccgctg tgccttcaggtgggggtgccattgctgtgggagctccagctgctgcatct ggtggtgccgccgcacctgctgctgagtcaaaggaggagaaggttgaaga gaaggaagaatctgatgaagacatgggtttcagtctgttcgactaagcgc ttcagttcctcccccctaccctctgtttaccctagtatctgtcgtgtgtg gcctgccacaacagcgcctgcataatatctagagacctaaagttcgtgct attttgcttgggacaatgtatatgtttagtaccttagtatgtgagtgtgt tactgcttccgcagcgttgagaagttgattgataatttgctggagttatg tttctctcaaaaaaaaaa
Download
page-top