Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257396
Length 537 bp
Fasta Format > whh10f05
gcgacgagtaccagaagtggcggtggcagcctgatgcctgcgacctccca aggttcgatgcgaagttgcttcttgagaagctaaggaacaaaagaatgat gtttgtgggggattcactgaacaggaaccagtgggagtccatggtgtgcc tggtccagtctgtggctccatgggataagaaaaagcttgtcaagaatgga tctctaaatgtgttccgccttaatgagtacaatgcaacgattgagttcta ttgggctcctttcctagttgagtcgaactcagatgatccagacatccata gcatcaccgaccgaatgatcacgccaacatcgatcgccaagcatgcagca aattggataggggtggactatttgatcttcaacacttacatttggtggat gaacaccccgaagatgaaaattgtgcctgacggatccttcacaaggaaac cagttaagtacgatgaattggatcgtgtggttgcgtaccgacagatcctc gagacatggtctggatgggtagaagagaatgtagatc
Download
page-top