Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257380
Length 497 bp
Fasta Format > whh10d21
cacccttaacagagttcgaccatcctgagaaaggcgatgccctgtatgca atggaattggctctagctcttgaaaagctggtgaatgagaaactgcacaa cctgcacagtgtagctacaaggtgcaatgatcctcagctgaccgactttg ttgagagtgaattccttcaggagcaggttgacgccatcaagaagatctct gagtatgtgtcgcagctgagaagagtcggcaaaggccacggagtgtggca cttcgatcagatgctgcttgaggaggcagcttgaaggacacgacgactac gggcaatggaggatgtaggtgtgatatgtcaagtagtggacagataagcc aaccactggatgtggttttcagggatttttgcagtgggatttgtagggta ctatgctgcgctgtgtttgggatttgaaataaaacgatgggagatgtgcc acgctcttaaatgccagtcttctgctctaatcttgctaaaaaaaaaa
Download
page-top