Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257369
Length 690 bp
Fasta Format > whh10d04
ggagagataggacttgtgcgccgcacgccaaacagcaggcacgcgagtcg agtcgttcccgttgttgcggccggcggaggaagagatggcgacgaacatc gaggacgtgccttcggtggagctcatgaccgagctgctccgtcgcgccaa gtgcagctccaagcccgacaagcgcatcatcctcgtcggtccacctggct ctggaaagggaacacagtctccccttattaaggatgaatattgtttgtgc catttagccactggcgatatgctgagggctgctgtcgccgctaagactcc tctgggtatcaaggctaaagaagctatggacaagggagagcttgtttcag atgacttggttgttgggattattgatgaagccatgaaaaaaccttcatgt caaaaaggttttatccttgatggcttccctagaactgttgttcaagcaca aaagctcgatgaaatgctcgcaaagcaaggtgctaaggttgacaaggttc taaattttgcaattgatgatgcaatattggaagaacgaattactggccgt tggatacacccatcgagtggtagatcttaccatacaaaatttgctcctcc caagactccgggagttgatgatgtttcgggagaacccttaattcaaagaa aagatgacacagctgaggtcttgaagtcaaggcttgaagc
Download
page-top