Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257367
Length 608 bp
Fasta Format > whh10d01
cttcgcaactcctcttcctggcatcaaccatgccgttctccgctggcctc gtttcccttgggtctccgccgccgcagcgccacagctgcaggttccagcg atatcagcgaccggggactctcatttcatcagctataagacatagtcagg ttaaagctatggctggagtgagcatggatggcttggcacagcctcaagcc ccggttgcagtggttaccggagcatcgagggggatcgggcgagcgatagc tgtggctcttgggaaagcagggtgcaaggtagttgtgaactatgcgaagt caggcatggaagctgaagaagtgcgcagagagatcgaggagtccggtggc actgccatcaccttttcagccgatgtctccattgaagctgaggttgaaac catgatgagagcggcaattgatacttggggaacgctggacgtcctggtga acaatgcagggatcacacgagatgctctgctaatgcggatgaagcgggca caatggcaggaagtagtggacgtaaaccttaccggtgtttacctctgtgc ccaggctgcggcggcagtgatgatgaagaggaagaagggaaggatcatca acatcgcc
Download
page-top