Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257363
Length 558 bp
Fasta Format > whh10c18
ggcaagcttcttcttcctgattaatactccagttgcctggccatcgatcg tcgtcctcgcattgcctagcggagaaggaagcggagatagttggcttctg gcgtgtggagatggcgtcgagggctatgatggtggcggtgctgctcgcgg cggtggcggcgacgtgcgcgcgggcgcagctgcatgagaagttctacggc gagacgtgccccagcgtggaggacgtcgtgaggaaggagatggtgagggc gctgtcacttgcgcccagcctcgccgggccgctcctccggatgcacttcc acgactgcttcgtcagggggtgcgacggctcggttctgctggactcggcc aacaagacggcggagaaggacgcgaagccgaaccagacgctccgtggctt cgacttcgtcgagaaggtgaaggccgccgtggagaaggcctgccctgaca ccgtctcctgcgccgacatactcgccctcatggccagggatgcagtctgg ctgagcaagggcccattctgggaagttcctttgggccggcgtgacggcag cgtgtcca
Download
page-top