Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ257362
Length 422 bp
Fasta Format > whh10c14
agggaggagtaccctgaccgaatgatgctgaccttctctgtcttcccatc accaaaggtctcagacaccgtcgttgagccatacaatgctacactttccg ttcaccaactcgttgagaacgctgatgagtgtatggtgcttgacaatgaa gctctatacgacatatgtttccgcacgctaaagcttgccaccccttcctt tggtgacctgaaccatcttatctctgctaccatgagcggtgtcacatgct gcctgaggttccctggacaactcaactccgatcttcgcaagcttgctgtc aatctcatcccattcccccgtctccacttcttcatggttggctttcgcgc cgctgacgtnacgtgggtcacaaatgtaccgtgctctcacagtccctgag ctgactcagcanatgtgggatg
Download
page-top